Art The Ultimate Expression Essays - Visual Arts, Art History

Art: The Ultimate Expression Art: The Ultimate Expression Before the portrayal of the human body can be critiqued, you must understand the artist's culture. As man evolved over centuries, his views of the body also transformed. Our tour definitely showed the drastic changes in different cultures' art. Each culture and era presents very distinct characteristics. Through time and experimentation, we have expressed our views of the human body clearly with our art. Egyptians were the first people to make a large impact on the world of art. Egyptians needed art for their religious beliefs more than decoration or self-gratification. The most important aspect of Egyptian life is the ka, the part of the human spirit that lives on after death. The ka needed a physical place to occupy or it would disappear. Most of the important men of Egypt paid to have their body carved out of stone. That was were the spirit would live after the man dies. They used stone because it was the strongest material they could find. Longevity was very important. The bodies are always idealized and clothed. Figures are very rigid, close-fisted, and are built on a vertical axis to show that the person is grand or intimidating. Most of the figures were seen in the same: profile of the legs, frontal view of the torso, and profile of the head. Like most civilizations, Egyptians put a lot of faith in gods. The sky god Horus, a bird, is found in a great amount of Egyptian art. Li ttle recognition was ever given to the artists. The emphasis was on the patron. Early Greek art was greatly influenced by the Egyptians. Geography permitted both cultures to exchange their talents. The beginning of Greek art is marked by the Geometric phase. The most common art during the Geometric phase was vase painting. After the vase was formed but before it was painted, the artist applied a slip (dark pigment) to outside. Then the vase was fired and the artist would incise his decorations into the hard shell. It was important to incise humans into the fired slip and not paint with slip. The people in the pictures needed light colored skin, which was the color beneath the slip, because Greeks wanted to make their art as realistic as possible. Much like Egyptian art, the Greeks idealized the bodies of the people in their works. As the Archaic Period evolved, Greek sculptures were almost identical to the Egyptians'. Unlike Egyptians, the Greeks refined their techniques. Greeks used marble to construct their sculptures. It was considered more valuable and beautiful than any material available. They softened the lines of the body. Greek sculptors slowly perfected every contour in the human figure. Greek people viewed the human body as something beautiful and so they depicted nude men. Women were eventually nude but only when there was a reason, they needed to be bathing or something where they would be naked. They people that are sculpted are always young and their bodies are still idealized. The Greeks invented contrapposto, the relaxed natural stance of a sculpture. A figure that is standing in contrapposto becomes a sculpture in the round, meaning that the emphasis is not only on a frontal view but also from all angles. The Hellenistic Period emerged as the Romans began to produce some of the finest art in history. This new revolutionary style was incredible. Figures weren't confined to the unnatural or boring positions they had for centuries. All body parts were in perfect proportion. These statues came alive as their limbs reached out into space. Vacant stares evolved into human emotions, which were easily recognized on their faces. I think this renaissance portrayed the way people were thinking. They were exploring philosophy, religion, and politics. This was a time for rebirth. Christian art was introduced during the middle of the second century. In many cases the only difference between Christian art and Hellenistic art is the religious subject matter. After a slow start the Christians introduced something new, the mosaic. Mosaics became a favorite medium for decorating churches. Man was viewed in religious scenes due to the spread of Christianity. Byzantine and medieval art was very representative. The artists' ability to produce lifelike

Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids The WritePass Journal

Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids Abstract Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids Abstract1. Introduction1.1 Schistosomiasis1.2 Genetic diversity; transmission and epidemiology of S.mansoni1.3 Drug resistance and vaccine development1.4 Mitotic recombination in the S. mansoni life cycle causing genetic variation1.5 Studying the genetic diversity of S.mansoni using molecular techniques2. Materials and Methods  2.1 Bioinformatics – RAPD primers2.2 Comparison of DNA extraction methods: Beltran et al. (2008) and DNeasy protocol2.3 Amplification of cercariae and Schistosome hybrid DNA by Polymerase chain reaction (PCR) using RAPD primers2.4 Analysis of RAPD PCR products 2.5 Amplification of schistosome hybrid DNA by polymerase chain reaction (PCR) using ITS-2 primers and the analysis of the PCR products3. Results3.1 Bioinformatics – RAPD primers  3.2 PCR products from the amplification of DNA from cercariae using RAPD markers3.3 PCR products from the amplification of DNA from schistosome hybrids using RAPD markers3.4 PCR products from the amplification of DNA from schistosome hybrids using ITS -2 primers4. Discussion4.1 DNA extraction4.2 Evidence of mitotic recombination in Schistosomes4.3 The use of RAPD and rDNA markers in emphasising genetic diversity within schistosomesReferencesRelated Abstract Random amplified polymorphic DNA markers and second internal transcriber region primers   have been used to assess the genetic diversity of Schistosoma mansoni and Schistosoma rodhaini hybrids. 20 schistosome hybrids were used and within these parasites 6 different genotypes were present. However,1 genotype was   in females and in males and so was not sex specific. The genetic diversity within this parasite population is caused by mitotic recombination occurring in the asexual stage of the life style.   This is thought to occur due to its ability of evading the snail immune system, hybrid breakdown and increased movement and turn over of the snail host. The Red Queen Hypothesis is also suggested as a reason for genetic diversity in the schistosome population. Key words: Schistosoma mansoni, Schistosoma rodhaini, DNA extraction, polymerase chain reaction, hybrids, RAPD, mitotic recombination, genetic diversity, ITS-2. 1. Introduction 1.1 Schistosomiasis Schistosomiasis is endemic in counties where there is inadequate sanitation and no access to clean water resulting in 700 million people worldwide being at risk of infection and 207 million people already infected (World Health Organisation 2011). The leading cause is Schistosoma mansoni, a blood fluke that causes intestinal schistosomiasis. This parasite is found in Africa and South America where it is a serious health problem (Simoes et al. 2007). The disease can manifest with abdominal pain, diarrhoea, dysentry and in some severe cases cause hepatosplenomegaly which is enlargement of the liver and spleen (World Health Organisation 2011). The adult worms are found in the venules that surrond the intestine (Mann et al. 2009). It is the eggs in the tissues of the gut and deep body organs rather than the adult worms that cause of the pathology of the disease by releasing proteolytic enzymes which result in an inflammatory response (Clerinx and Gompel 2011). 1.2 Genetic diversity; transmission and epidemiology of S.mansoni The World Health Organisation (2011) have highlighted that schistosomiasis is now the second most important parasitic disease after malaria in terms of public health and economic impact, enhancing the severity of the problems that schistosomes can cause. Therefore, further research into methods which   will improve understanding of genetic variation of S. mansoni in the context of epidemiology and disease transmission in endemic areas (Durand et al. 2000). Considering the distribution of genetic diversity within the parasite population allows for a greater understand of the epidemiological factors which could influence the prevalence   of the disease (Thiele et al. 2008), especially with the concern of drug resistance and heterogeneity in virulence and pathology cause by different parasite population (Caillaud et al. 2006). 1.3 Drug resistance and vaccine development Praziquantel is commonly used to treat schistosomiasis and there is evidence to suggest resistance is becoming apparent (Ismail et al. 1999). The presence of non-synonymous mutations can affect the binding sites of drugs because these mutations are able to cause structural alterations in proteins causing drug resistance (Simoes et al. 2007). For this reason Berquist et al. (2002) suggest that a vaccine is needed against schistosomiasis as contemporary drugs such as praziquantel do not halt the transmission of the infection or stop re-infection from occurring. Due to the variability of antigens, studying the range of epitopes across the S. mansoni population is vital to vaccine development (Curtis and Minchella 2000). 1.4 Mitotic recombination in the S. mansoni life cycle causing genetic variation During the life cycle of S. mansoni (Figure 1) the miracidium infect Biomphalaria snails which act as the intermediate host which produce cercariae, humans are infected when cercariae penetrate the skin (Gryseels et al. 2006). Recombination occurs at a much lower frequency in mitosis than meiosis and is usually a rare occurrence (Archetti 2003). However, genetic diversity within the population of S. mansoni is caused by mitotic recombination during the asexual stage of the cycle (Bayne and Grevelding 2003). Grevelding (1999) also showed that the heterogeneity found among clonal cercariae all coming from a single miracidium infection, was a result of mitotic recombination events within the snail host during sporocystogenesis.   Mitosis should usually cause a single genotype, however, mitotic recombination is thought to be the cause of genetic diversity because of the presence of multiple genotypes. Figure 1 – The life cycle of Schistosoma mansoni In contrast, Sire et al. (1999) suggest that genetic diversity is greatly reduced when there is a single miracidium infection, this is justified in the study as they found that 88.4% of the snails produced single – parasite genotypes when infected with a single miracidium. However, they also found that a smaller amount of snails harboured multiple genotypes, evidential of mitotic recombination occurring. 1.5 Studying the genetic diversity of S.mansoni using molecular techniques Gower et al. (2007) suggested that a relevant problem in the in molecular studies of schistosomes is that adult worms are not easily available to study due to where they are found in the human body as they are in blood vessels that surround the intestine. Therefore, most studies involve infecting snails and using the cercariae to either infect laboratory mammals in order to extract the adult worms, or using the cercariae for their DNA and then conducting molecular studies (Gower et al. 2007). Molecular markers can be used to assess the genetic diversity by identifying parasite genotypes that have been collected from snail hosts (Dabo et al. 2007) Random amplified polymorphic DNA markers use oligonucleotides as primers to amplify DNA fragments (Lynch et al. 1994) . Sire et al. (1999) studied the genetic diversity and the distribution pattern of S.mansoni genotypes using RAPD markers and found that there were different genotypes of the parasite, 49 in total. RAPD markers are seen to be advantageous due to several factors such as quick analysis, but a major advantage is that they are able to detect numerous sequences in the DNA (Barral et al. 1996). RAPD markers are also reproducible as it is possible to the same genotype from the same individual numerous times (Figure 2 – Gel picture for reproducible RAPDs). However, an issue with using RAPD markers is that usually only highlight dominant genes (Barral et al. 1996). As they are also random a limitation is that it is not possible to know exactly where in the sequence that marker has attached itself to. Restriction fragment length polymorphisms can also be used to analyse DNA sequence differences in S.mansoni, highlighting the genetic diversity within the parasite population (Rodrigues 2002). By using other molecular markers that are highly polymorphic such as microsatellites, which are simple sequences of tandem repeated DNA (Chambers and MacAvoy 2000), the genetic diversity of S.mansoni between different hosts can be studied (Durand et al. 1995).   Gower et al. (2007) also suggest that the use of multi-locus microsatellites to highlight the genetic variation of schistosome larvae will enhance the knowledge about what is known of the epidemiology of the parasite. In this study RAPD markers were used to assess the genetic diversity of cercariae from a single miracidium infection, 10 female and 10 male S. mansoni and S. rodhaini hybrids. ITS – 2 primers were also used to discover if there was any genetic diversity amongst the second internal transcribed region of the ribosomal gene complex. The use of RAPD primers in this study should be able to show that mitotic recombination is happening within the asexual stage of the life cycle. The hypothesis of this study is to show that through the use of RAPD and ITS-2 primers mitotic recombination is occurring within the asexual stage of the schistosome life cycle. 2. Materials and Methods   2.1 Bioinformatics – RAPD primers Bioinformatic analysis was performed on 5 different RAPD primers (Table 1) to show that the primers attach themselves to random parts of the DNA sequence. The scaffold, the position in the scaffold and the features marking that part of the sequence were noted. This gave a complete genome perspective by ensuring that the primers were not binding to specific gene types or to a single region of the genome. Table   1. RAPD markers and the sequences they attach themselves to. RAPD primer Sequence OP- A9 GGGTAACGCC OP- A13 CAGCACCCAC OP G13 CTCTCCGCCA OP- A10 GTGATCGCAG OP B6 TGCTCTGCC 2.2 Comparison of DNA extraction methods: Beltran et al. (2008) and DNeasy protocol For the first DNA extractions a number of snails, Biomphalaria glabrata were infected with a single miracidium infection. In total 12 snails were infected for this experiment and 32 cercariae were collected from each snail. The DNA extraction method used on the cercariae was proposed by Beltran et al. (2008). For the DNA extraction 8 cercariae from a single snail which were each isolated   in 5 µl of purified water and then transferred to an eppendorf tube. 20 µl of NaOH (250mM) was then added to each tube and this was incubated for 15 minutes at 25 ºC. The samples were then heat shocked at 99 ºC for 2 minutes. The next step taken was to add 10 µl HCl (250mM), 5 µl   of Tris – HCl (500mM) and 5 µl   of Triton X – 100 ºC (2%) and this was again heat shocked at 99 ºC for 2 minutes. The samples were then stored at 20 ºC ready for PCR to be performed. The second method for the DNA extraction used a DNeasy protocol to extract the DNA from 20 schistosome hybrids. The hybrids used were produced from mono miracidial infections of Biomphalaria with female S.mansoni from Egypt and male S.rodhaini from Burundi from a previous experiment performed by Dr Scott Lawton. Firstly, 200 µl of AL was added to each of the schistosomehybrid DNA samples and was mixed by vortexing, following this 200 µl of ethanol was then added to each sample before vortexing again. This mixture was then placed into a DNeasy Mini spin column 2ml collection tube and centrifuged at 8000rpm for 1 minute. The DNeasy mini spin column was then placed into a new 2ml collection tube, 500 µl of buffer AW1 was added and it was again centrifuged for 1 minute at 8000rpm and again the DNeasy mini spin column was placed into a new 2ml collection tube. 500 µl of buffer AW2 was then added and was centrifuged for 3 minutes at 14 000rpm. The DNeasy column was then placed into a microcentrifuge tube and 200 µl of AE was added directly onto the DNeasy membrane, incubated at room temperature for 1 minutes and then then centrifuged at 8000rpm for 1 minute. 2.3 Amplification of cercariae and Schistosome hybrid DNA by Polymerase chain reaction (PCR) using RAPD primers PCR was performed using five primers described previously (Table 1); OP A9, OP A10, OP A13, OP G13 and OP B6. 2.5 µl of each DNA sample, 2 µl of each of the 5 different primers and 12.5 µl of PCR master mix containing Taq DNA Polymerase were added into separate PCR tubes. The DNA samples were firstly heated to 95 ºC for 15 minutes, then subjected to 40 cycles of 95 ºC for 1 minute followed by single cycles of 47 ºC for 1 minute and 72 ºC for 2 minutes. There was then a final elongation stage of 72 ºC for 10 minutes and then finally run to 4 ºC 2.4 Analysis of RAPD PCR products All PCR products were analysed using agarose gel electrophoresis was used to separate the DNA. 1% agarose gel was used in TAE and   8 µl of GelRed 10 000X in water (Biotium) was added to the gel. 5 µl   of each DNA sample was mixed with loading dye and placed into each separate well in the gel. A ladder was placed along side the DNA samples using a Bioline Hyperladder 1 ranging from 200bp to 10 000bp. The gel rack was then connected to the power supply and was allowed to run for 40 minutes. This gel was then visualised using a gel doc system. 2.5 Amplification of schistosome hybrid DNA by polymerase chain reaction (PCR) using ITS-2 primers and the analysis of the PCR products For the PCR using ITS-2 primers, 2 primers were added to each DNA sample from 5 female and 5 male schistosome hybrids, ITS-F (GGTACCGGTGGATCACGTGGTG) and ITS-R (CCTGGTTAGTTTCTTTTCCTCCGC). 2.5 µl of each DNA sample was added to a separate PCR tube, to this 12.5 µl of   PCR master mix (Thermo-Scientific) containing Taq DNA Polymerase, 5.0 µl of ITS-F and 5.0 µl of ITS-R was also added to each separate PCR tube. The PCR was then run at 95 ºC for 15 minutes, followed by 40 cycles at 95 ºC for 1 minute. The samples were then subjected to single cycles of 52 ºC for 1 minute and 72 ºC for 2 minutes and there was a final elongation stage at 72 ºC for 10 minutes before being run at 4 ºC. The PCR products were then run agarose gel electrophoresis using the same method used for the RAPD primers and the gel was visualised using a gel doc system. Sequencing of the ITS -2 regions was unsuccesful and therefore sequencing generated by Steinauer et al. (2008) were analysed to access if any mixing of the parental genotypes had occurred by identifying differences in single nucleotide polymorphisms within the F1 offspring. Sequences were downloaded from NCBI and aligned using clustalW2 (ebi.ac.uk/Tools/msa/clustalw2/). Alignments were then visualised using BioEdit to visualise nucleotide differences between the sequences. 3. Results 3.1 Bioinformatics – RAPD primers   BLAST searches on the RAPD primers showed that some of the sequences that the primers attached themselves to coded for proteins whilst others did not, highlighting that they are random (Lynch and Milligan 1994). Primers appear to bind to [rachel da1]  the different parts of the DNA sequence, for instance part of the sequence which codes for a specific protein and features marking that part of the sequence are shown. Where there is no feature it means that the sequence is a non-coding region (Table 2). Table 2. BLAST analysis on the RAPD primers 3.2 PCR products from the amplification of DNA from cercariae using RAPD markers Using the DNA extraction method suggested by Beltran et al. (2008) no PCR products were present on the gel when agarose gel electrophoresis was used (Figure 2). This method was therefore no longer used and the DNeasy kit was employed.    Figure 2. Gel picture showing that no DNA was present. 3.3 PCR products from the amplification of DNA from schistosome hybrids using RAPD markers RAPD PCR products from 10 female and 10 male schistosome hybrids were indicative that there were 4 genotypes found in the female DNA; A, B, C and D and 2 in the male DNA; E and F (Figure 3). However, genotypes D and F are the same, one being in the female population and one in the male showing that they are not sex specific. Figure 3. Showing 5 different genotypes in the schistosome hybrids. Genotype A: 1, 2, 4, 5, 6. Genotype B: 3. Genotype C: 10. Genotype D: 7, 8, 9. Genotype E: 11, 14, 17,18,20. Genotype F: 12, 13, 15, 16, 19. Table 3 shows the different sizes of each of the bands present for each genotype. Table 3. The size of bands present in each genotype 1000bp 800bp 600bp 200bp Genotype A * * * Genotype B * * * * Genotype C * * ** Genotype D * * * Genotype E * * Genotype F * * * *Band present **Double band present 3.4 PCR products from the amplification of DNA from schistosome hybrids using ITS -2 primers Double banding patterns were seen in the ITS – 2 PCR fragments, this is unexpected as the PCR should have produced a single discrete band (Figure 4). Figure 4.   Bands are present at 400bp and 200bp in both the male and female schistosome hybrids. It was not possible to sequence the ITS-2 region and so published data was used and analysed as described previously. Clear mixing of the parental genotypes can be seen (Table 4). For each SNP position mixing can be seen in the offspring with some nucleotides being from the S. mansoni parent and some from the S. rodhaini parent. [rachel da2] Table 4. Single nucleotide polymorphisms betweeen the parent species of Schistosoma mansoni (yellow) and Schistosoma rodhaini (red) and the resultant F1 offspring for published data on the ITS-1 marker. The SNPs appear not to exist as alleles and clear mixing of the parental genotypes can be seen in the offspring. SNP position 97 224 284 419 589 882 941 Species and Isolate                      (AF53134) S. mansoni A C T G C T A (AY446078) S. rodhaini G T C A G C G EU599378 G T T A G ? ? EU599377 A C T G G ? ? EU599376 A T C A G ? ? EU599375 A T C G G ? ? EU599374 A C T A G ? ? EU599373 A C C G G ? ? EU599372 A C C A G ? ? EU599371 A T T G G ? ? EU599370 G C C A G ? ? EU599369 G C C G G ? ? EU599368 G C T A G ? ? EU599367 G C T G G ? ? EU599366 G T C A G ? ? EU599365 G T C G G ? ? EU599364 G T T G G ? ? AF531313 G T C A C C G 4. Discussion 4.1 DNA extraction In this study a DNA extraction method suggested by Beltan et al. (2009) was used. An attempt at extracting DNA from 8 cercariae from a single miracidial infection of a snail and 20 Schistosome hybrids was performed and even though this DNA extraction method was said to be advantageous using small amounts of DNA , no bands were found to be present for RAPD or ITS-2 markers. Beltran et al. (2008) showed that from 10 cercariae the method was 98% and 100% successful in first and second amplifications retrospectively, however the results of this study indicate no DNA to be present suggesting that the protocol was not as 100% efficient as suggested. It could be that Beltran et al. (2008) analysed the DNA without using gel electrophoresis and other methods of analysing DNA[rachel da3]   were more suitable for this DNA extraction. However, it could also be the case that there were no cercariae to extract DNA from but this is unlikely as the cercariae were collected for the purposes of this study.[rachel da4] Alternatively, the DNeasy protocol used to extract the DNA from the adult hybrid worms proved to be more effective. Beltran et al. (2008) suggested that other methods of DNA extraction took time and were far more complex and even though this may be the case, the longer DNeasy protocol was far more effective at yielding DNA for this study. 4.2 Evidence of mitotic recombination in Schistosomes From a single miracidial infection of F1 hybrids, 6 genotypes have been produced supporting the theory by Bayne and Grevelding et al. (2003) that mitotic recombination is occurring in the asexual stage of the parasites life cycle within Biomphalaria snails. Although Sire et al. (1999) strongly suggested that genetic diversity was greatly reduced[rachel da5]   when there is a single miracidium infection the evidence from this study shows this to be incorrect due to the numerous genotypes observed. Multiple genotypes were seen in F1 generation produced from single miracidial infection which is indicative of recombination events. Recombination normally only happens during meiosis, however, this would not have had the opportunity to happen in the F1 thus recombination must have taken place during the asexual stage of of the life cycle. Hybrid breakdown occurs when the genetics that control physiology and development breakdown (Burton 1990) because of two gene pools and so two different sets of chromosomes mixing (Dobzhansky 1950). Therefore, a consequence of this hybrid breakdown could be mitotic recombination occurring and causing increased genetic diversity within the schistosome population. S. mansoni and S. rodhaini hybrids occur naturally (Morgan et al. 2003), and so it may be questionable   whether there are any pure species of schistosomes due to this naturally occuring hybridisation. Consequently if this hybridisation is occurring naturally all the time then increased genetic diversity within a schistosome population would be present. The host Biomphalaria snails only have an innate immune system (Minchella 1984). Therefore, if the parasite population has a high diversity of different genotypes the snail would not recognise them all as antigens allowing some strains to survive and so mitotic recombination could be a mechanism by which diversity arises in order for the parasite to evade the snail immune system (Caillaud et al. 2006). Sire et al. (1999) suggest that genetic diversity may be seen if there is higher productivity of snail hosts, due to an increased number of snails dying in response to a heavy parasite burden. Therefore, the different genotypes of the snail host that the parasite would be in contact with could affect the genetic diversity of the parasite. It is also suggested that if there is increased movement of the intermediate host, the Biomphalaria snail, it would encounter various different parasite genotypes from   other snail hosts (Sire et al. 1999). Therefore genetic diversity within schist osomes would be present. In this study mitotic recombination has caused greater genetic diversity in the female   parasite. This is vital for reproduction as it is the female that produces eggs (Clough 1981) therefore if more female genotypes able to evade the snail immune system and survive it means an increase in reproduction. The Red Queen Hypothesis is a co-evolutionary hypothesis suggesting that as the Biomphalaria snail host genes evolve the genes of the parasite that allow infectivity of the host will evolve alongside them (Van Valen 1973). Therefore, it could be this evolution of the parasite genes (Figure 6) affecting the ability of the schistosome population to infect the snail host which causes the genetic diversity (Carius et al. 2001). Figure 6. Red Queen Hypothesis showing the co-evolution of the snail host and the parasite. 4.3 The use of RAPD and rDNA markers in emphasising genetic diversity within schistosomes In this study the use of RAPD markers have been successful in highlighting the different genotypes present amongst S.mansoni and S.rodhaini hybrids. RAPD markers are therefore successful at allowing for genetic diversity to be quantified (Langand et al. 1999). RAPD markers have enabled the quantification of the different genotypes of the schistosome hybrids in this study and this is supported by Barral et al. (1996) who concluded that RAPD markers were efficient at providing a way of displaying genetic diversity within a schistosome population. Using reproducible RAPD markers is advantageous as it validates the results of this experiment as if the experiment was repeated the same results would be produced. If after repeating, the same results were found as reproducible RAPD markers were used it would further conclude that genetic diversity is definitely present in schistosome population. For the schistosome hybrids two ITS-2 bands were present on the gel and the reason for this is unclear. It could be due to lack of specific species barriers this second band has appeared. It could also be due to priming on another site, such as a viral or transposable element which has similarities to ITS-2 has inserted itself into the genome and how shown up on the gel as a second ITS band. Although it was not possible to sequence the ITS – 2 region, the sequencing generated by Steinauer et al. (2008) showed that there was genetic diversity within the F1 offspring. This genetic variation could also be caused by mitotic recombination happening within the asexual stage of the life cycle. References Archetti, M. (2003) A selfish origin for recombination. Journal of Theoretical Biology,  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   223(3), 335-346. Barral, V., Morand, S., Pointier, J.P., and Theron, A. (1996) Distribution of schistosome genetic diversity within naturally infected Rattus rattus detected by RAPD markers. Parasitology, 113(6), 511 – 517. Bayne, C.J., and Grevelding, C.G. (2003) Cloning of Schistosoma mansoni sporocysts in vitro and detection of genetic heterogeneity among individuals   within  Ã‚  Ã‚  Ã‚   clones. The Journal of Parasitology, 89(5), 1056-1060. Beltran, S., Galinier, R., Allienne, J., and Boissier, J. (2008) Cheap, rapid and  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  efficient DNA extraction method to perform multilocus microsatellite genotyping on all Schistosoma mansoni stages. Memà ³rias do Instituto   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Oswaldo Cruz, 103(5), 501-503. Berquist, R., Al-Sherbiny, M., Barakat, R., and Olds, R. (2002) Blueprint for schistosomiasis vaccine development. Acta tropica, 82(2), 183 – 192. Burton, R.S. (1990) Hybrid breakdown in developmental time in the copepod Tigriopus californicus. Evolution, 44(7), 1814 – 1822. Caillaud, D., Prugnolle, F., Durand, P., Theron, A. and de Meeus, T. (2006) Host sex and parasite genetic diversity. Microbes and Infection, 8(9-10), 2477 – 2483. Carius, H.J., Little, T.J. and Ebert, D. (2001) Genetic variation in host-parasite association: potential for coevolution and frequency-dependent selection. Evolution 55(6), 1136-1145. Chambers, G.K., and MacAvoy, E.S. (2000) Microsatellites: Consensus and controversy. Comparitive Biochemistry and Physiology, 126(4), 455 – 476. Clerinx, J., and Van Gompel, A. (2011) Schistosomiasis in travellers and migrants. Travel Medicine and Infections Disease, 9(1), 6-24. Clough, E.R. (1981) Morphology of Reproductive Organs and Oogenesis in Bisexual and Unisexual Transplants of Mature Schistosoma mansoni Females. The Journal of Parasitology, 67(4), 535-539. Curtis, J., and Minchella, D.J. (2000) Schistosome Population Genetic Structure: When Clumping Worms is not just splitting hairs. Parasitology Today, 16(2), 68-71. Dabo, A., Durand, P., Morand, S., Diakite, M., Langand, J., Imbert-Establet, D., Doumbo, O., and Jourdane, J. (1997) Distribution and genetic diversity of Schistosoma haematobium within its bulinid intermediate hosts in Mali. Acta Tropica, 66 (1), 15-26. Dobzhansky, T. (1950) Genetics of natural populations. XIX. Origin of heterosis through natural selection in populations of Drosophila pseudoobscura. Genetics 35(3), 288 – 302. Durand, P., Sire, C., and Theron, A. (2000) Isolation of microsatellite markers in the digenetic trematode Schistosoma mansoni from guadeloupe island. Molecular Ecology, 9(7), 997-998. Dybdahl, M.F. And Storfer, A. (2003) Parasite local adaptation: Red Queen versus Suicide King. Trends in ecology and evolution 18(10), 523-530. Gower, C.M., Shrivastava, J., Lamberton, P.H.L., Rollinson, D., Webster, B.L., Emery, A., Kabatereine, N.B., and Webster, J.P. (2007) Development and application of an ethically and epidemiologically advantageous assay for the multi-locus microsatellite analysis of Schistosoma mansoni. Parasitology, 134(4), 523-536. Grevelding, C. G. (1999) Genomic instability in Schistosoma mansoni. Molecular and Biochemical Parasitology, 101(1-2), 207-216. Gryseels, B., Polman, K., Clerinx, J., and Kestens, L. (2000) Human schistosomiasis. The Lancet, 368(9541), 1106-1118. Ismail, M., Botros, S., Metwally, A., William, S., Farghally, A., Tao, L. F., Day, T.A., and Bennett, J.L. (1999) Resistance to praziquantel: Direct evidence from Schistosoma mansoni isolated from egyptian villagers. The American Journal of Tropical Medicine and Hygiene, 60(6), 932-935. Langand, J., Theron, A., Pointier, J.P., Delay, B., and Jourdane, J. (1999) Population structure of Biomphalaria Glabrata, intermediate snail host of Schistosoma mansoni in Guadeloupe Island using RAPD markers. Journal of Molluscan Studies, 65(4), 425-433. Lynch, M., and Milligan B.G. (2004) Analysis of population genetic structure with RAPD markers. Molecular Ecology, 3(2), 91-99. Mann, V.H., Morales, M.E., Rinaldi, G., and Brindley, P.J. (2009) Culture for genetic manipulation of developmental stages of Schistosoma mansoni. Parasitology, 137(3), 451-462. Minchella, D.J. (1984) Host life-history variation in response to parasitism. Parasitology, 90(1), 205-216. Morgan, J.A.T., DeJong, R.J., Lwambo, N.J.S., Mungai, B.N., Mkoji, G.M. and Loker, E.S. (2003) First report of a natural hybrid between Schistosoma mansoni and S. rodhaini. The Journal of Parasitology, 89(2), 416-418. Rodrigues, N., Coura Filho, P., De Souza, C., Jannoti Passos, L., Dias-Neto, E., and Romanha, A. (2002) Populational structure of Schistosoma mansoni assessed by DNA microsatellites. International Journal for Parasitology, 32(7), 843-851. Simoes, M., Bahia, D., Zerlotini, A., Torres, K., Artiguenave, F., Neshich, G., Kuser, P., and Oliveira, G. (2007) Single nucleotide polymorphisms identification in expressed genes of Schistosoma mansoni. Molecular and Biochemical Parasitology, 154(2), 134-140. Sire, C., Durand, P., Pointier, J. P., and Thà ©ron, A. (1999) Genetic diversity and recruitment pattern of schistosoma mansoni in a Biomphalaria glabrata snail population: A field study using random-amplified polymorphic DNA markers. The Journal of Parasitology, 85(3), 436-441.

Study of The UK Food Manufacturing 2036 Essay Example | Topics and Well Written Essays - 6000 words

Study of The UK Food Manufacturing 2036 - Essay Example The paper has deployed a number of strategic management techniques to determine market condition, consumer demand and position of the companies thereof. SWOT, PEST and Porter’s five force analyses were considered appropriate. Besides business environment, financial and non-financial performance of each company has been assessed along with their cumulative performance for a period of five years. The paper has elaborately discussed every aspect of business with respect to the subject companies using ratio analysis. The outcomes have also been critically assessed and recommendations have been provided keeping in view the future scope of growth and development for the firms. The food sector in the United Kingdom (UK) can be chiefly segmented in four areas, namely, food manufacturing, food retailing, food wholesaling and non-residential catering. Food is an essential purchase among all others by consumers and growth of food sector is being significantly driven by increasing population. Between 1992 and 2008, the food sector of the UK grew parallel with economic boom and stabilised by 2012. The food manufacturing sector is significantly dominated by different kind of foods that can be conveniently categorised as necessity food and luxury food and be further subdivided into other categories (DEFRA, 2014a; Manley, 2010). The diversified nature of the UK food industry and its contribution in the UK economy makes it an interesting choice of research. The food manufacturing sector is an essential part of the food industry as it acts as a link between agro-food industry of raw material and food retailing and wholesaling. Food manufacturing is also essential for the food industry because it generate employment, provides export opportunities, minimises scope of import and results in great value addition to local produces and local crop producers (ILO, 2014). The research paper