Sustainability Report For Gorilla Health Bars Pty Ltd And...

SUSTAINABILITY REPORT FOR GORILLA HEALTH BARS PTY LTD Student Name: Ali Alfaifi ID: 17655159 Executive summary Purpose Come up with sustainability solution and strategies to Gorilla Health Bars Pty Ltd and at the same time provide recommendations for future considerations. Scope of investigation Access relevant information from available number of sources, the company itself and other learning materials. Methodology Analyze all learning resources and academic journals with the sole purpose of finding sustainable solutions to the company’s current problems. Findings Present a range of sustainable solutions to the manager for consideration Right away, initiate adoption of adequate sustainable strategies. Conclusions and recommendations†¦show more content†¦Finding and discussions Sustainability approach to the problem 1. Communication of the high need of sustainability goals to all members of the company, Everyone needs to understand and be committed to ensuring that the same is met. 2. The company should take small and very smart initial changes. Achieving sustainability will not be a walk in the park. As a result, they should initiate a small change in initial stages that will not cost much but have an immense effect. 3. Renovate the warehouse and include ventilation system on the roof that will regulate temperature. With the issue of rise and falling of temperature handled, the electric bill will consequently drop massively. 4. Dig a borehole. Since the company is in a rural place, the can decide to dig a long term borehole that will address the high usage of water used in the production of goods. 5. Chain up with suppliers to be bringing the raw materials to the company premises. Business is about doing transaction in the right way that sees one spending minimum costs. Since the different raw materials are in separate places, the company should come up with an agreement of the suppliers to be bringing the raw material to the company. Disadvantages Can be costly to the comp any. Results will be realized after some times. It may mean hiring more employees that the company had not planned for. Conclusion

Andrew Jackson The Fifth Us President Essay - 2292 Words

Andrew Jackson, born 15 March 1767, was the seventh US President (1829-1837) and was a part of the Democratic Party (Andrew Jackson - U.S. Presidents - HISTORY.com, 2009). His early life began in hardship in poverty as a son of Irish immigrants whose family died during the British invasion of the Carolinas (1780-1781) (Andrew Jackson - U.S. Presidents - HISTORY.com, 2009). Despite life’s unforgiving nature, he managed to study law during his teenage life and challenged the Carolina bar in 1787 (Andrew Jackson - U.S. Presidents - HISTORY.com, 2009). He later moved to Tennessee, in a place that would later become Nashville, where he became a prosecuting attorney (Andrew Jackson - U.S. Presidents - HISTORY.com, 2009). Jackson became sufficient enough to become a slave owner, became the first man elected to the US House of Representatives from Tennessee, and was later elected as a judge to the Tennessee superior court (Andrew Jackson- Whitehouse.gov). With the War of 1812 Jackson became a Major General and won a series of battles, to include, the Battle of Tohopeka in Alabama against the Creek Indians in 1914, against the British at New Orleans in 1815, and an his invasion of Florida against Spain in 1817 (Andrew Jackson - U.S. Presidents - HISTORY.com, 2009). His status of national hero was solidified in the public by this time. Before winning the presidency in 1828, he lost his first run against John Quincy Adams in 1824 due to his failure to obtain the majority ofShow MoreRelatedLyndon B. Johnson And Andrew Jackson1605 Words   |  7 PagesEditor- Very recently, your newspaper held a poll nominating which US president to be the fifth face on the famous Mount Rushmore. The top choice was Reagan, along with others, including Lyndon B. Johnson and Andrew Jackson. I believe that Reagan does certainly deserve the honor- as a US president, Ronald Reagan changed the country, taking it out of its post-Carter economic and political gloom, won the Cold War without a bloody confrontation, and created more reforms for the economyRead MoreThe United States1307 Words   |  6 PagesConvention, representatives from most of the states, instead of revising the Articles wrote an entirely new document; the Constitution. Called â€Å"a bundle of compromises†it has gone over many interpretations but it is essentially the same document that governs us today.And because so many different people and politicians have different opinions on it, it could be called â€Å"a living document†. The Constitution, however, was not signed without arguments and compromise. The first issue was between states with largeRead More Andrew Jacksons Presidency And Policies Essay1868 Words   |  8 Pages Andrew Jacksonamp;#8217;s Presidency and Policies nbsp;nbsp;nbsp;nbsp;nbsp;In American history many acts of cruelty and or unjustified beliefs were acted upon. Some of these events were led by citizens and in some cases, such as the case of Andrew Jackson, led by presidents. Andrew Jackson was the seventh president of the United States of America from 1829-1837.1 His presidency and policies, such as the Indian Removal Act, and his part in The Second Bank of the U.S and South Carolinaamp;#8217;sRead MoreCause of the Civil War1296 Words   |  6 Pagesachievements the United States experienced industrial revolution. This happened on the North. The southern states remained using archaic form of slave exploitation and plantation system. At the Constitutional Convention the South had to agree to three-fifths compromise, when 5 slaves counted as 3 free men toward representation in Congress. This was probably the only case when Southern representatives mentioned that even though slaves are property they were human beings. Such â€Å"a sacrifice† ensured legalRead MoreAnalysis Of Andrew Jackson s The White House Essay2607 Words   |  11 PagesAndrew Jackson once said, â€Å"Take time to deliberate; but when the time for action arrives, stop thinking and go in.† Andrew Jackson was an individual who was filled with integrity, grit, determination, and other values that encompass a good leader. The chosen book about this man is titled American Lion: Andrew Jackson in the White House. The creator of this Pulitzer Prize winning novel would be Jon Meacham. The Chattanooga born author graduated at The University of the South in Sewanee, TennesseeRead MorePresidential Outline of Andrew Jackson2515 Words   |  11 Pages(1841-1845) III. Education and Occupation A. President Van Buren didn’t receive much education as a child. His parents were Dutch and spoke fluent Dutch. His father, Abraham, owned a tavern. In the tavern, Van Buren spent much of his childhood observing, studying, and listening to the political arguments there, giving him some experience. His formal education ended at the age of 14. B. At the stunning age of 13, President Jackson entered the army in the American Revolution. ThisRead MoreCh 12 Essay1177 Words   |  5 Pagesregion and burned the new capital of Washington to the ground in August 1814. They then were beaten off in the battle at Fort McHenrynear Baltimore that inspired Francis Scott Key to write the Star Spangled Banner. Finally, the victory of Gen. Andrew Jackson, over the British at New Orleans in January 1815 gave a boost to national morale, even though, because of slow communications, it was actually fought after the Treaty of Ghent had been signed, officially ending the war. Why do the authors sayRead MoreThe American Of The United States1766 Words   |  8 PagesOnyx Finn Katherine Jackson History 121 04 March 2015 The 1800s From 1819 to about 1839 many events took place in the United States. The Panic of 1819, this was the very first financial crisis in the United States. This caused many banks to close and many people to go into debt. The Monroe Doctrine was a document stating that the United States did not want the Europeans interfering with American affairs. The Jacksonian Democracy, Andrew Jackson wanted the Europeans to stop further colonization.Read MoreAmerica s Independence Of Independence Essay2128 Words   |  9 Pagesthe three-fifths compromise which counted sixty percent of slaves created by Rutledge who demanded slaves be allowed to vote. With the creation of a new constitution came the anti-federalist party which were against the constitution and included popular figures like Sam Adams, George Clinton, Richard Lee, Thomas Jefferson and James Monroe. As well as a party Federalist and by 1788-1789 nine out of 13 states ratified the constitution and the U.S Constitution takes effect on 1789 . As the us populationRead MoreSam Houston1033 Words   |  5 Pageshis name in history. Sam Houston was born in Shenandoah, the fifth of nine children. Self educated and highly motivated to move off the farm, Sam Houston ran away at 15 to live with the Cherokee (Buenger). After three years with the Cherokee, and two years teaching for money, Sam Houston joined the army where he quickly raised in rank. Due to his military service, Sam Houston came to the attention of Future President, General Andrew Jackson, who became the mentor or still a young Sam Houston (Marquis)

Adaptation Mcdonalds Free Essays

McDonald’s Going International International Marketing Mag. K. Roth Group 2 Florian Antos Vladimir Slon Christoph Gluszko 1 Christian Schromm ALL YOU WANTED TO KNOW ABOUT McDonald’s 2 History †¢ McDonald’s Corporation – is the world’s largest chain of fastfood restaurants, primarily selling hamburgers, chicken, French fries, milkshakes and soft drinks. We will write a custom essay sample on Adaptation Mcdonalds or any similar topic only for you Order Now More recently, it also offers salads, fruit and carrot sticks. The business began in 1940, with a restaurant opened by Dick and Mac McDonald in San Bernardino, California. Their introduction of the â€Å"Speedee Service System† in 1948 established the principles of the modern fast-food restaurant. The present corporation dates its founding to the opening of a franchised restaurant by Ray Kroc, in Illinois on April 15, 1955, the ninth McDonald’s restaurant overall. Kroc later purchased the McDonald brothers’ equity in the company and led its worldwide expansion. 3 †¢ †¢ †¢ †¢ What are the advantages and disadvantages of adaptation strategy used by McDonald’s? 4 1. Advantages and Disadvantages of adaptation strategy Advantages: †¢ Different cultures have different consumer needs and tastes †¢ Political and legal environment of the international market that they plan to enter †¢ Differences among nations in terms of cultures, religious believes, political and legal systems, customer values and lifestyles, and stages of economic and market development †¢ Differences in the advancement of technology †¢ Competition plays a major role in determining if a company will adopt a product adaptation scheme 1. Advantages and Disadvantages of adaptation strategy Disadvantages: †¢ The costs associated with adaptation can also play a major role in determining whether or not a firm chooses to standardize their product 6 1. Advantages and Disadvantages of adaptation strategy †¢ †¢ †¢ Cross any boarder and you will find multiple variations from price to product, starting with the presentation. Misconception that McDon alds is the same everywhere. Country teams have considerable autonomy to develop and market new product lines. Menu differences: Netherlands and Austria– Beer Germany – Chinese Week Canada – Mc Pizza India – Goat and lamb burgers half of menu vegetarian Japan – ingredients such as cabbage and Teriyaki USA – Barbecue bacon Burgers, sausage breakfast burritos 7 Are there examples of truly global brands that never customized? 8 Are there examples of truly global brands that never customized? Truly global Brands : †¢ In general we can say that straight extension (=standardization) has been implemented and already been successful with cameras, consumer electronics, and many machine tools. Stihl ( machinery and chainsaw producer) Nikon Olympus, Canon ( camera producers) Kitchen Aid (consumer electronics ) Caterpillar (trucks, bulldozers) †¢ †¢ †¢ †¢ 9 What have been the key factors that have led to McDonald’s global success? 10 2. What have been the key factors that have led McDonalds to global success? †¢ †¢ †¢ Fast service enabled by a limited menu, focus on cleanliness, family friendly facilities, good value for money Emergence of cash-rich, time-poor lifestyle Societal acceptance of a more casual approach to eating on the run underscored the emergence of McDonalds Innovations in food preparation technology and service delivery providing a fast- service format that customers appreciate as well as a cost base that competitors found hard to match Waiter labor cost savings passed on directly to the consumers through lower prices McDonalds was the leader to introduce franchising in the global marketplace, augmenting the organic restaurant growth by harnessing the management, cultural and entrepreneurial capabilities and capital of local businesspeople around the world. Expanding across the globe Increasing restaurant penetration in already existing markets †¢ †¢ †¢ 11 2. What have been the key factors that have led McDonalds to global success? Key Faktors: †¢ †¢ †¢ †¢ †¢ †¢ Economies of scale in production and distribution Power and scope Brand image was country suited Ability to leverage ideas quickly and efficiently Uniformity of marketing practices Pervasiveness of McDonalds brand 12 2. What have been the key factors that have led McDonalds to global success? †¢ †¢ †¢ †¢ †¢ McDonald’s is seen as the number one representative of the all American lifestyle, which at the time when the expansion began was very popular. In some countries it is still a status symbol to go and have a meal at McDonald’s. Generally the cooperation is at pains to offer a selection of standardized core products ( Big Mac, Soft drinks, French Fries) in addition to locally accepted alternatives. Giving the multinational cooperation a local Face (thinking of Salzburg’s restaurant) In order to use synergies on the one hand and reduce national competences on the other a supranational administrative department had been set up in Europe. McDonald’s. has always been supported by US foreign policy Sources : http://de. wikipedia. org/wiki/McDonald’s; Kotler/Keller Marketing Management 13 What are the risks and benefits of choosing the franchising system for franchisor? 14 3. Risks and Benefits of franchise system Benefits for franchisor: The franchisor profits from the strongly motivated franchisee as a self-dependent entrepreneur †¢ The franchising as a way to overcome the resource scarcity through the direct market access †¢ The ability to overcome the high costs of arranging the new distribution network through using the well tailored network of franchisor †¢ Low capital investments for the product placement and region marketing through the franchisee †¢ The benefits from using a recognized brand name and trade marks through the reputation of the franchisor †¢ Extended expansion possibility through franchising 15 3. Risks and Benefits of franchise system Risks for franchisor: †¢ The existence of multiple, geographically dispersed owner-managers makes the control difficult †¢ Possible high costs of training development, promotional and support activities of franchisee †¢ Service delivery may be inconsistent because of geographically dispersed franchisees 16 What are the key issues by setting up a McDonald’s Franchisee? 17 4. Risks and Benefits of franchise system Benefits for the franchisee: †¢ Your business is based on a proven idea. You can check how successful other franchises are before committing yourself. †¢ You can use a recognized brand name and trade marks. You benefit from any advertising or promotion by the owner of the franchise – the â€Å"franchisor†. †¢ The franchisor gives you support – usually including training, help setting up the business, a manual telling you how to run the business and ongoing advice. †¢ Financing the business may be easier. Banks are sometimes more likely to lend money to buy a franchise with a good reputation. †¢ Risk is reduced and is shared by the franchisor. †¢ If you have an existing customer base you will not have to invest time looking to set one up. Relationships with suppliers have already been established. †¢ The ability to overcome the resource constrains. 18 4. Risks and Benefits of franchise system Risks for franchisee: †¢ Costs may be higher than you expect. As well as the initial costs of buying the franc hise, you pay continuing royalties and you may have to agree to buy products from the franchisor. †¢ The franchise agreement usually includes restrictions on how you run the business. You might not be able to make changes to suit your local market. †¢ The franchisor might go out of business, or change the way they do things. †¢ Other franchisees could give the brand a bad reputation. You may find it difficult to sell your franchise – you can only sell it to someone approved by the franchisor. 19 4. Costs and Restrictions Costs: Financial Requirements/Down Payment : Initial down payment for opening (40% of the total cost) or an existing restaurant (25% of the total cost) about 200. 000 $ nonborrowed resources Financing: McDonald’s does not offer financing; McDonald’s Owner/Operators enjoy the benefits of our established relationships with many national lending institutions 20 4. Costs and Restrictions Restrictions: During the term of the franchise, you pay McDonald’s the following fees: †¢ Service fee: a monthly fee based upon the restaurant’s sales performance (currently a service fee of 4. 0% of monthly sales). Rent: a monthly based rent or percentage rent that is a percentage of monthly sales. †¢ Application: Personal, non-borrowed resources to be invested in a McDonald’s restaurant business. †¢ Business experience in the market where they are seeking a franchise 21 What strategy would you adopt to ensure a great exposure for McDonald’s to a growing trend towards healthier eating? 22 5. Healthier eating at McDonald’s Currently: †¢ †¢ Low fat products in UK outlet Canadian light choices of Menu with a Soya bean McVeggie Burger, salads with a fat free dressing and a granola topped fruit yoghurt On packaging calorie and fat content information for the first time as it tries to counter the obesity lobby †¢ 23 5. Healthier eating at McDonald’s Future perspectives: †¢ †¢ †¢ †¢ †¢ †¢ Using biologically grown resources Fat reduced meals Healthier ways of processing the food (eg. : don’t fry chips but bake them, less white bread burgers, regular vegetarian dishes,) Healthy, freshly squeezed Mc Shakes etc. Healthier Drinks not only Sodas To ensure high-quality, fresh ingredients, farms are set up in order to supply restaurants 24 Sources: †¢ †¢ †¢ †¢ †¢ www. McDonalds. com www. freeforessays. com/show_essay/55461. html D. Jobber â€Å"Principles and Practice of Marketing† Sources : http://de. wikipedia. org/wiki/McDonald’s Kotler/Keller Marketing Management 25 THANK YOU FOR YOUR ATTENTION 26 How to cite Adaptation Mcdonalds, Essay examples

Psychodrama Therapy What Is It Essay Sample free essay sample

Psychodrama is an active and originative curative attack that uses guided play and function playing to work through jobs. Developed by Dr. Jacob Moreno. psychodrama can be effectual separately or in a group ( sociodrama ) . and is sometimes offered in mental wellness plans. schools and concerns. During each psychodrama session. participants reenact specific scenes and experiences with counsel from a healer. These scenes may include past state of affairss. dreams and readyings for future events. In a group puting. other participants play the functions of important others or the audience. offering support and delivery to the surface underlying beliefs and issues. What is Psychodrama Therapy Like? In this signifier of therapy. clients will frequently play out multiple scenarios that depict specific life events. phantasies. dreams. or mental provinces. These dramatic presentations represent a client’s perceptual experience of a state of affairs or are creative activities of their emotional processing mechanism. The healer may promote the client to take on other functions or assign individualities to objects to spread out the scene. Psychodrama is a really effectual tool when applied in a group puting. When psychodrama is conducted in forepart of an audience. the engagement is centripetal and reactive. The supporter may even ask for the audience to take part further through verbal or physical actions. hence making a larger field through which the curative procedure can be. Each Psychodrama session Consists of Three Phases: Warm-up. Action and Sharing. WARM-UP is designed to bring forth ambiance of originative possibility. This stage is concerned with set uping sociometric connexions. edifice coherence and increasing spontaneousness. At this stage issues and concerns cardinal to the group emerge and a supporters is chosen. The supporter may be chosen by the group. by the leader or by oneself. The group becomes the safe container. the uterus within which a kid is warmed up to the ultimate self-generated act of birth. Action: The protagonist stairss on the phase to take action on his behalf. to do alterations around the issue he/she identified as a trouble in the warm-up stage. The supporter holds the purpose and portions it with the group and the manager. The action is wholly unscripted ; blossoming as the supporter moves from scene to scene. unblocking spontaneousness. acquiring closer to his centre to the truth. through enchantment and katharsis to new penetrations and originative. fresh ways of being. Throughout the whole procedure he experiences consistent support and counsel from the manager who utilizes techniques such as role-reversal. duplicating. mirroring. excess world. etc. to assist the procedure. Other group members are involved by either playing subsidiary functions in the protagonist’s play. or by duplicating. or by keeping the energy of the infinite for the supporter and for thems’elves and by take parting emotionally in the protagonist’s narrative. Sharing: After the passage is complete the protagonist re-enters the group. He/she had given the generous gift of courage and truth. and it is now his stomach to rest and have while other members of the group portion with himlher their feelings and penetrations that were brought up by the protagonist’s play. After taking a immense hazard of exposing his inner battles. the supporter can hear other people portion similar painful feelings and experiences. so he feels accepted. supported and underst ood for who he/she is. What used to be private shame becomes public triumph for all involved as the existent human experiences are revealed and shared. OVERVIEW OF PSYCHODRAMA ELEMENTS AND TECHNIQUES Supporter: A group member in the centre of a psychodrama ordaining a subject from his/her personal life or a theme chosen by the group as a cardinal concern. â€Å"The supporter is asked to be himself on the phase. to portray his ain private universe. He is told to be himself. non an histrion. as the histrion is compelled to give his ain private ego to the function imposed upon him by a dramatist †¦ no 1 every bit much an authorization on himself as himself’ . ( Moreno. 1953 ) A supporter takes action on his ain behalf. and by making that is instrumental in catalysing alterations non merely for his ain benefit but besides for the benefit of the whole group. The group assists the supporter in making the work. Director: A healer trained in psychodrama whose function is to excite spontaneousness. to steer. construction. co-produce the psychodrama with/for the supporter and for the group. â€Å"The supporter holds the key to the inner and outer universe. The manager holds the door which opens and stopping points and the group provides the frame† . Audience: The group watching the play supplying a safe container and supportive witnessing. Having your interior universe. experiences. battles and discoveries being witnessed by others dispels the protagonist’s shame and isolation. Private shame becomes a public triumph ; what used to be hidden in the shadow comes into the limelight in positive. authorising ways. Members of the audience are available to play subsidiary functions in the protagonist’s play. to duplicate and to portion their personal experiences/feelings/insights in response to the protagonist’s work in the sharing stage of the play. Aide: A group member who plays a function in the protagonist’s play. Aides can be chosen for the function by the supporter or by the manager. In some instances trained aides may be used. Double: A specialised aide who takes on the portion of the interior ego of the supporter. The map of the two-base hit is to supply the supporter with the experience of being to the full supported and understood. to help the supporter in intensifying the feeling and penetration. The more support and credence is experienced by the supporter. the safer they feel. the more hazards they are willing to take. the more self-generated they are traveling to be. the more originative picks and solutions will go available to them. For group members practising duplicating allows for the experience of empathy and dividing it from personal projections. it satisfies act hungriness and increases relatedness. Doubling as a technique is used by the manager for the intents stated above. It is besides a really utile technique to utilize in single. twosomes and household therapy. THE Phase: The sacred infinite. the safe container of the mind where the supporter enacts his/her ain perceptual experiences of the universe in which he/she lives. It is â€Å"the topographic point of unpretending† where the truth is found and spoken. THE MOMENT: Psychodramatic construct of clip is that everything is go oning in here and now. All action takes topographic point in the present. As we center in our consciousness of ourselves in the present we become declarative of our interior obstructions. countries of tenseness in our lives. The passage takes us back to the topographic point and clip where we got stuck in forms of comprehending ourselves and the universe that do non function us any longer. By animating that â€Å"present† which surrounded a past minute. we can bring out the kineticss of the minute ; explore the relationships. the feelings in the context within they occurred. But this clip around the â€Å"psychodrama tic cocoon† allows for new declarations to emerge. Therefore the new experience replaces the old one covering our old memory of that minute. making a â€Å"corrective emotional experience† that frees us up for the new ways of being. â€Å"Every true 2nd life through the experience is the alleviation and release from the fITst† ( Moreno ) . ROLE REVERSAL: The basic of psychodrama techniques. which allows the supporter to see themselves and the state of affairs through the eyes other than our ain. MIRRORING: The technique that allows the supporter to see his/her state of affairs and him/herself from the exterior. SURPLUS REALITY: Removes the boundaries between what we consider our â€Å"reality† and imaginativeness. In fact. whatever we can conceive of can go on. If it could non go on. we would non be able to conceive of it. I refer to it as a fact because I see once more and once more my clients’ wished for scenarios. concreticized and dramatized via psychodramatic passages. so manifest in their lives. The same manner the clip collapses in psychodrama. so does the inner and outer universe of a individual. Our interior head speaks in metaphors ; so concreticized metaphors become portion of the action as they represent an of import portion of the protagonist’s mind. As we are co-creating our world. anything is possible. whether it is projecting an ideal vision of one’s hereafter or re-creating the losing experiences from the yesteryear. Often in psychodrama people in the protagonist’s life who died or were absent are brought into a duologue. so that what was losing could be completed and healed. â€Å"There are certain unseeable dimensions in the world of life. non to the full experienced or expressed †¦ . and for those who failed to see them. life is uncomplete †¦ that is why we have to utilize excess operations and excess instruments to convey them out in our curative scenes. † ( Moreno. 1966 ) Goals and Purpose of Psychodrama. The primary end of Psychodrama is to increase the impulsivity of our ain emotions in a extremely organized. yet originative and productive mode. It is intended to give an unfastened forum for the find and geographic expedition of internal and external struggles and disfunctions through dramatic drama. Most Sessionss will last for up to two hours and go around around the primary character. the supporter. By prosecuting other characters. the supporter can larn a great trade about their ain interpersonal accomplishments and explicate the proper techniques to build positive and effectual behavioural alterations. This method of therapy challenges the client. and all of the characters involved. in a new and exciting manner that expands their boundaries of experience. WHAT CONDITIONS/DISORDERS DOES PSYCHODRAMA TREAT?Psychodrama is used to handle a assortment of conditions. including: †¢ Addiction†¢ Trauma†¢ Autism†¢ Eating Disorders†¢ Adoption and Attachment Issues WHAT ARE THE BENEFITS OF PSYCHODRAMA?Psychodrama can be a powerful experience. Because it is an active. â€Å"real-time† therapy. psychodrama can be an authorising option totraditional talk therapy. Psychodrama can assist people: †¢ Improve their relationships and communicating accomplishments†¢ Overcome heartache and loss†¢ Restore assurance and wellbeing†¢ Enhance acquisition and life accomplishments†¢ Express their feelings in a safe. supportive environment†¢ Experiment with new ways of thought and behaving

Art The Ultimate Expression Essays - Visual Arts, Art History

Art: The Ultimate Expression Art: The Ultimate Expression Before the portrayal of the human body can be critiqued, you must understand the artist's culture. As man evolved over centuries, his views of the body also transformed. Our tour definitely showed the drastic changes in different cultures' art. Each culture and era presents very distinct characteristics. Through time and experimentation, we have expressed our views of the human body clearly with our art. Egyptians were the first people to make a large impact on the world of art. Egyptians needed art for their religious beliefs more than decoration or self-gratification. The most important aspect of Egyptian life is the ka, the part of the human spirit that lives on after death. The ka needed a physical place to occupy or it would disappear. Most of the important men of Egypt paid to have their body carved out of stone. That was were the spirit would live after the man dies. They used stone because it was the strongest material they could find. Longevity was very important. The bodies are always idealized and clothed. Figures are very rigid, close-fisted, and are built on a vertical axis to show that the person is grand or intimidating. Most of the figures were seen in the same: profile of the legs, frontal view of the torso, and profile of the head. Like most civilizations, Egyptians put a lot of faith in gods. The sky god Horus, a bird, is found in a great amount of Egyptian art. Li ttle recognition was ever given to the artists. The emphasis was on the patron. Early Greek art was greatly influenced by the Egyptians. Geography permitted both cultures to exchange their talents. The beginning of Greek art is marked by the Geometric phase. The most common art during the Geometric phase was vase painting. After the vase was formed but before it was painted, the artist applied a slip (dark pigment) to outside. Then the vase was fired and the artist would incise his decorations into the hard shell. It was important to incise humans into the fired slip and not paint with slip. The people in the pictures needed light colored skin, which was the color beneath the slip, because Greeks wanted to make their art as realistic as possible. Much like Egyptian art, the Greeks idealized the bodies of the people in their works. As the Archaic Period evolved, Greek sculptures were almost identical to the Egyptians'. Unlike Egyptians, the Greeks refined their techniques. Greeks used marble to construct their sculptures. It was considered more valuable and beautiful than any material available. They softened the lines of the body. Greek sculptors slowly perfected every contour in the human figure. Greek people viewed the human body as something beautiful and so they depicted nude men. Women were eventually nude but only when there was a reason, they needed to be bathing or something where they would be naked. They people that are sculpted are always young and their bodies are still idealized. The Greeks invented contrapposto, the relaxed natural stance of a sculpture. A figure that is standing in contrapposto becomes a sculpture in the round, meaning that the emphasis is not only on a frontal view but also from all angles. The Hellenistic Period emerged as the Romans began to produce some of the finest art in history. This new revolutionary style was incredible. Figures weren't confined to the unnatural or boring positions they had for centuries. All body parts were in perfect proportion. These statues came alive as their limbs reached out into space. Vacant stares evolved into human emotions, which were easily recognized on their faces. I think this renaissance portrayed the way people were thinking. They were exploring philosophy, religion, and politics. This was a time for rebirth. Christian art was introduced during the middle of the second century. In many cases the only difference between Christian art and Hellenistic art is the religious subject matter. After a slow start the Christians introduced something new, the mosaic. Mosaics became a favorite medium for decorating churches. Man was viewed in religious scenes due to the spread of Christianity. Byzantine and medieval art was very representative. The artists' ability to produce lifelike

Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids The WritePass Journal

Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids Abstract Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids Abstract1. Introduction1.1 Schistosomiasis1.2 Genetic diversity; transmission and epidemiology of S.mansoni1.3 Drug resistance and vaccine development1.4 Mitotic recombination in the S. mansoni life cycle causing genetic variation1.5 Studying the genetic diversity of S.mansoni using molecular techniques2. Materials and Methods  2.1 Bioinformatics – RAPD primers2.2 Comparison of DNA extraction methods: Beltran et al. (2008) and DNeasy protocol2.3 Amplification of cercariae and Schistosome hybrid DNA by Polymerase chain reaction (PCR) using RAPD primers2.4 Analysis of RAPD PCR products 2.5 Amplification of schistosome hybrid DNA by polymerase chain reaction (PCR) using ITS-2 primers and the analysis of the PCR products3. Results3.1 Bioinformatics – RAPD primers  3.2 PCR products from the amplification of DNA from cercariae using RAPD markers3.3 PCR products from the amplification of DNA from schistosome hybrids using RAPD markers3.4 PCR products from the amplification of DNA from schistosome hybrids using ITS -2 primers4. Discussion4.1 DNA extraction4.2 Evidence of mitotic recombination in Schistosomes4.3 The use of RAPD and rDNA markers in emphasising genetic diversity within schistosomesReferencesRelated Abstract Random amplified polymorphic DNA markers and second internal transcriber region primers   have been used to assess the genetic diversity of Schistosoma mansoni and Schistosoma rodhaini hybrids. 20 schistosome hybrids were used and within these parasites 6 different genotypes were present. However,1 genotype was   in females and in males and so was not sex specific. The genetic diversity within this parasite population is caused by mitotic recombination occurring in the asexual stage of the life style.   This is thought to occur due to its ability of evading the snail immune system, hybrid breakdown and increased movement and turn over of the snail host. The Red Queen Hypothesis is also suggested as a reason for genetic diversity in the schistosome population. Key words: Schistosoma mansoni, Schistosoma rodhaini, DNA extraction, polymerase chain reaction, hybrids, RAPD, mitotic recombination, genetic diversity, ITS-2. 1. Introduction 1.1 Schistosomiasis Schistosomiasis is endemic in counties where there is inadequate sanitation and no access to clean water resulting in 700 million people worldwide being at risk of infection and 207 million people already infected (World Health Organisation 2011). The leading cause is Schistosoma mansoni, a blood fluke that causes intestinal schistosomiasis. This parasite is found in Africa and South America where it is a serious health problem (Simoes et al. 2007). The disease can manifest with abdominal pain, diarrhoea, dysentry and in some severe cases cause hepatosplenomegaly which is enlargement of the liver and spleen (World Health Organisation 2011). The adult worms are found in the venules that surrond the intestine (Mann et al. 2009). It is the eggs in the tissues of the gut and deep body organs rather than the adult worms that cause of the pathology of the disease by releasing proteolytic enzymes which result in an inflammatory response (Clerinx and Gompel 2011). 1.2 Genetic diversity; transmission and epidemiology of S.mansoni The World Health Organisation (2011) have highlighted that schistosomiasis is now the second most important parasitic disease after malaria in terms of public health and economic impact, enhancing the severity of the problems that schistosomes can cause. Therefore, further research into methods which   will improve understanding of genetic variation of S. mansoni in the context of epidemiology and disease transmission in endemic areas (Durand et al. 2000). Considering the distribution of genetic diversity within the parasite population allows for a greater understand of the epidemiological factors which could influence the prevalence   of the disease (Thiele et al. 2008), especially with the concern of drug resistance and heterogeneity in virulence and pathology cause by different parasite population (Caillaud et al. 2006). 1.3 Drug resistance and vaccine development Praziquantel is commonly used to treat schistosomiasis and there is evidence to suggest resistance is becoming apparent (Ismail et al. 1999). The presence of non-synonymous mutations can affect the binding sites of drugs because these mutations are able to cause structural alterations in proteins causing drug resistance (Simoes et al. 2007). For this reason Berquist et al. (2002) suggest that a vaccine is needed against schistosomiasis as contemporary drugs such as praziquantel do not halt the transmission of the infection or stop re-infection from occurring. Due to the variability of antigens, studying the range of epitopes across the S. mansoni population is vital to vaccine development (Curtis and Minchella 2000). 1.4 Mitotic recombination in the S. mansoni life cycle causing genetic variation During the life cycle of S. mansoni (Figure 1) the miracidium infect Biomphalaria snails which act as the intermediate host which produce cercariae, humans are infected when cercariae penetrate the skin (Gryseels et al. 2006). Recombination occurs at a much lower frequency in mitosis than meiosis and is usually a rare occurrence (Archetti 2003). However, genetic diversity within the population of S. mansoni is caused by mitotic recombination during the asexual stage of the cycle (Bayne and Grevelding 2003). Grevelding (1999) also showed that the heterogeneity found among clonal cercariae all coming from a single miracidium infection, was a result of mitotic recombination events within the snail host during sporocystogenesis.   Mitosis should usually cause a single genotype, however, mitotic recombination is thought to be the cause of genetic diversity because of the presence of multiple genotypes. Figure 1 – The life cycle of Schistosoma mansoni In contrast, Sire et al. (1999) suggest that genetic diversity is greatly reduced when there is a single miracidium infection, this is justified in the study as they found that 88.4% of the snails produced single – parasite genotypes when infected with a single miracidium. However, they also found that a smaller amount of snails harboured multiple genotypes, evidential of mitotic recombination occurring. 1.5 Studying the genetic diversity of S.mansoni using molecular techniques Gower et al. (2007) suggested that a relevant problem in the in molecular studies of schistosomes is that adult worms are not easily available to study due to where they are found in the human body as they are in blood vessels that surround the intestine. Therefore, most studies involve infecting snails and using the cercariae to either infect laboratory mammals in order to extract the adult worms, or using the cercariae for their DNA and then conducting molecular studies (Gower et al. 2007). Molecular markers can be used to assess the genetic diversity by identifying parasite genotypes that have been collected from snail hosts (Dabo et al. 2007) Random amplified polymorphic DNA markers use oligonucleotides as primers to amplify DNA fragments (Lynch et al. 1994) . Sire et al. (1999) studied the genetic diversity and the distribution pattern of S.mansoni genotypes using RAPD markers and found that there were different genotypes of the parasite, 49 in total. RAPD markers are seen to be advantageous due to several factors such as quick analysis, but a major advantage is that they are able to detect numerous sequences in the DNA (Barral et al. 1996). RAPD markers are also reproducible as it is possible to the same genotype from the same individual numerous times (Figure 2 – Gel picture for reproducible RAPDs). However, an issue with using RAPD markers is that usually only highlight dominant genes (Barral et al. 1996). As they are also random a limitation is that it is not possible to know exactly where in the sequence that marker has attached itself to. Restriction fragment length polymorphisms can also be used to analyse DNA sequence differences in S.mansoni, highlighting the genetic diversity within the parasite population (Rodrigues 2002). By using other molecular markers that are highly polymorphic such as microsatellites, which are simple sequences of tandem repeated DNA (Chambers and MacAvoy 2000), the genetic diversity of S.mansoni between different hosts can be studied (Durand et al. 1995).   Gower et al. (2007) also suggest that the use of multi-locus microsatellites to highlight the genetic variation of schistosome larvae will enhance the knowledge about what is known of the epidemiology of the parasite. In this study RAPD markers were used to assess the genetic diversity of cercariae from a single miracidium infection, 10 female and 10 male S. mansoni and S. rodhaini hybrids. ITS – 2 primers were also used to discover if there was any genetic diversity amongst the second internal transcribed region of the ribosomal gene complex. The use of RAPD primers in this study should be able to show that mitotic recombination is happening within the asexual stage of the life cycle. The hypothesis of this study is to show that through the use of RAPD and ITS-2 primers mitotic recombination is occurring within the asexual stage of the schistosome life cycle. 2. Materials and Methods   2.1 Bioinformatics – RAPD primers Bioinformatic analysis was performed on 5 different RAPD primers (Table 1) to show that the primers attach themselves to random parts of the DNA sequence. The scaffold, the position in the scaffold and the features marking that part of the sequence were noted. This gave a complete genome perspective by ensuring that the primers were not binding to specific gene types or to a single region of the genome. Table   1. RAPD markers and the sequences they attach themselves to. RAPD primer Sequence OP- A9 GGGTAACGCC OP- A13 CAGCACCCAC OP G13 CTCTCCGCCA OP- A10 GTGATCGCAG OP B6 TGCTCTGCC 2.2 Comparison of DNA extraction methods: Beltran et al. (2008) and DNeasy protocol For the first DNA extractions a number of snails, Biomphalaria glabrata were infected with a single miracidium infection. In total 12 snails were infected for this experiment and 32 cercariae were collected from each snail. The DNA extraction method used on the cercariae was proposed by Beltran et al. (2008). For the DNA extraction 8 cercariae from a single snail which were each isolated   in 5 µl of purified water and then transferred to an eppendorf tube. 20 µl of NaOH (250mM) was then added to each tube and this was incubated for 15 minutes at 25 ºC. The samples were then heat shocked at 99 ºC for 2 minutes. The next step taken was to add 10 µl HCl (250mM), 5 µl   of Tris – HCl (500mM) and 5 µl   of Triton X – 100 ºC (2%) and this was again heat shocked at 99 ºC for 2 minutes. The samples were then stored at 20 ºC ready for PCR to be performed. The second method for the DNA extraction used a DNeasy protocol to extract the DNA from 20 schistosome hybrids. The hybrids used were produced from mono miracidial infections of Biomphalaria with female S.mansoni from Egypt and male S.rodhaini from Burundi from a previous experiment performed by Dr Scott Lawton. Firstly, 200 µl of AL was added to each of the schistosomehybrid DNA samples and was mixed by vortexing, following this 200 µl of ethanol was then added to each sample before vortexing again. This mixture was then placed into a DNeasy Mini spin column 2ml collection tube and centrifuged at 8000rpm for 1 minute. The DNeasy mini spin column was then placed into a new 2ml collection tube, 500 µl of buffer AW1 was added and it was again centrifuged for 1 minute at 8000rpm and again the DNeasy mini spin column was placed into a new 2ml collection tube. 500 µl of buffer AW2 was then added and was centrifuged for 3 minutes at 14 000rpm. The DNeasy column was then placed into a microcentrifuge tube and 200 µl of AE was added directly onto the DNeasy membrane, incubated at room temperature for 1 minutes and then then centrifuged at 8000rpm for 1 minute. 2.3 Amplification of cercariae and Schistosome hybrid DNA by Polymerase chain reaction (PCR) using RAPD primers PCR was performed using five primers described previously (Table 1); OP A9, OP A10, OP A13, OP G13 and OP B6. 2.5 µl of each DNA sample, 2 µl of each of the 5 different primers and 12.5 µl of PCR master mix containing Taq DNA Polymerase were added into separate PCR tubes. The DNA samples were firstly heated to 95 ºC for 15 minutes, then subjected to 40 cycles of 95 ºC for 1 minute followed by single cycles of 47 ºC for 1 minute and 72 ºC for 2 minutes. There was then a final elongation stage of 72 ºC for 10 minutes and then finally run to 4 ºC 2.4 Analysis of RAPD PCR products All PCR products were analysed using agarose gel electrophoresis was used to separate the DNA. 1% agarose gel was used in TAE and   8 µl of GelRed 10 000X in water (Biotium) was added to the gel. 5 µl   of each DNA sample was mixed with loading dye and placed into each separate well in the gel. A ladder was placed along side the DNA samples using a Bioline Hyperladder 1 ranging from 200bp to 10 000bp. The gel rack was then connected to the power supply and was allowed to run for 40 minutes. This gel was then visualised using a gel doc system. 2.5 Amplification of schistosome hybrid DNA by polymerase chain reaction (PCR) using ITS-2 primers and the analysis of the PCR products For the PCR using ITS-2 primers, 2 primers were added to each DNA sample from 5 female and 5 male schistosome hybrids, ITS-F (GGTACCGGTGGATCACGTGGTG) and ITS-R (CCTGGTTAGTTTCTTTTCCTCCGC). 2.5 µl of each DNA sample was added to a separate PCR tube, to this 12.5 µl of   PCR master mix (Thermo-Scientific) containing Taq DNA Polymerase, 5.0 µl of ITS-F and 5.0 µl of ITS-R was also added to each separate PCR tube. The PCR was then run at 95 ºC for 15 minutes, followed by 40 cycles at 95 ºC for 1 minute. The samples were then subjected to single cycles of 52 ºC for 1 minute and 72 ºC for 2 minutes and there was a final elongation stage at 72 ºC for 10 minutes before being run at 4 ºC. The PCR products were then run agarose gel electrophoresis using the same method used for the RAPD primers and the gel was visualised using a gel doc system. Sequencing of the ITS -2 regions was unsuccesful and therefore sequencing generated by Steinauer et al. (2008) were analysed to access if any mixing of the parental genotypes had occurred by identifying differences in single nucleotide polymorphisms within the F1 offspring. Sequences were downloaded from NCBI and aligned using clustalW2 (ebi.ac.uk/Tools/msa/clustalw2/). Alignments were then visualised using BioEdit to visualise nucleotide differences between the sequences. 3. Results 3.1 Bioinformatics – RAPD primers   BLAST searches on the RAPD primers showed that some of the sequences that the primers attached themselves to coded for proteins whilst others did not, highlighting that they are random (Lynch and Milligan 1994). Primers appear to bind to [rachel da1]  the different parts of the DNA sequence, for instance part of the sequence which codes for a specific protein and features marking that part of the sequence are shown. Where there is no feature it means that the sequence is a non-coding region (Table 2). Table 2. BLAST analysis on the RAPD primers 3.2 PCR products from the amplification of DNA from cercariae using RAPD markers Using the DNA extraction method suggested by Beltran et al. (2008) no PCR products were present on the gel when agarose gel electrophoresis was used (Figure 2). This method was therefore no longer used and the DNeasy kit was employed.    Figure 2. Gel picture showing that no DNA was present. 3.3 PCR products from the amplification of DNA from schistosome hybrids using RAPD markers RAPD PCR products from 10 female and 10 male schistosome hybrids were indicative that there were 4 genotypes found in the female DNA; A, B, C and D and 2 in the male DNA; E and F (Figure 3). However, genotypes D and F are the same, one being in the female population and one in the male showing that they are not sex specific. Figure 3. Showing 5 different genotypes in the schistosome hybrids. Genotype A: 1, 2, 4, 5, 6. Genotype B: 3. Genotype C: 10. Genotype D: 7, 8, 9. Genotype E: 11, 14, 17,18,20. Genotype F: 12, 13, 15, 16, 19. Table 3 shows the different sizes of each of the bands present for each genotype. Table 3. The size of bands present in each genotype 1000bp 800bp 600bp 200bp Genotype A * * * Genotype B * * * * Genotype C * * ** Genotype D * * * Genotype E * * Genotype F * * * *Band present **Double band present 3.4 PCR products from the amplification of DNA from schistosome hybrids using ITS -2 primers Double banding patterns were seen in the ITS – 2 PCR fragments, this is unexpected as the PCR should have produced a single discrete band (Figure 4). Figure 4.   Bands are present at 400bp and 200bp in both the male and female schistosome hybrids. It was not possible to sequence the ITS-2 region and so published data was used and analysed as described previously. Clear mixing of the parental genotypes can be seen (Table 4). For each SNP position mixing can be seen in the offspring with some nucleotides being from the S. mansoni parent and some from the S. rodhaini parent. [rachel da2] Table 4. Single nucleotide polymorphisms betweeen the parent species of Schistosoma mansoni (yellow) and Schistosoma rodhaini (red) and the resultant F1 offspring for published data on the ITS-1 marker. The SNPs appear not to exist as alleles and clear mixing of the parental genotypes can be seen in the offspring. SNP position 97 224 284 419 589 882 941 Species and Isolate                      (AF53134) S. mansoni A C T G C T A (AY446078) S. rodhaini G T C A G C G EU599378 G T T A G ? ? EU599377 A C T G G ? ? EU599376 A T C A G ? ? EU599375 A T C G G ? ? EU599374 A C T A G ? ? EU599373 A C C G G ? ? EU599372 A C C A G ? ? EU599371 A T T G G ? ? EU599370 G C C A G ? ? EU599369 G C C G G ? ? EU599368 G C T A G ? ? EU599367 G C T G G ? ? EU599366 G T C A G ? ? EU599365 G T C G G ? ? EU599364 G T T G G ? ? AF531313 G T C A C C G 4. Discussion 4.1 DNA extraction In this study a DNA extraction method suggested by Beltan et al. (2009) was used. An attempt at extracting DNA from 8 cercariae from a single miracidial infection of a snail and 20 Schistosome hybrids was performed and even though this DNA extraction method was said to be advantageous using small amounts of DNA , no bands were found to be present for RAPD or ITS-2 markers. Beltran et al. (2008) showed that from 10 cercariae the method was 98% and 100% successful in first and second amplifications retrospectively, however the results of this study indicate no DNA to be present suggesting that the protocol was not as 100% efficient as suggested. It could be that Beltran et al. (2008) analysed the DNA without using gel electrophoresis and other methods of analysing DNA[rachel da3]   were more suitable for this DNA extraction. However, it could also be the case that there were no cercariae to extract DNA from but this is unlikely as the cercariae were collected for the purposes of this study.[rachel da4] Alternatively, the DNeasy protocol used to extract the DNA from the adult hybrid worms proved to be more effective. Beltran et al. (2008) suggested that other methods of DNA extraction took time and were far more complex and even though this may be the case, the longer DNeasy protocol was far more effective at yielding DNA for this study. 4.2 Evidence of mitotic recombination in Schistosomes From a single miracidial infection of F1 hybrids, 6 genotypes have been produced supporting the theory by Bayne and Grevelding et al. (2003) that mitotic recombination is occurring in the asexual stage of the parasites life cycle within Biomphalaria snails. Although Sire et al. (1999) strongly suggested that genetic diversity was greatly reduced[rachel da5]   when there is a single miracidium infection the evidence from this study shows this to be incorrect due to the numerous genotypes observed. Multiple genotypes were seen in F1 generation produced from single miracidial infection which is indicative of recombination events. Recombination normally only happens during meiosis, however, this would not have had the opportunity to happen in the F1 thus recombination must have taken place during the asexual stage of of the life cycle. Hybrid breakdown occurs when the genetics that control physiology and development breakdown (Burton 1990) because of two gene pools and so two different sets of chromosomes mixing (Dobzhansky 1950). Therefore, a consequence of this hybrid breakdown could be mitotic recombination occurring and causing increased genetic diversity within the schistosome population. S. mansoni and S. rodhaini hybrids occur naturally (Morgan et al. 2003), and so it may be questionable   whether there are any pure species of schistosomes due to this naturally occuring hybridisation. Consequently if this hybridisation is occurring naturally all the time then increased genetic diversity within a schistosome population would be present. The host Biomphalaria snails only have an innate immune system (Minchella 1984). Therefore, if the parasite population has a high diversity of different genotypes the snail would not recognise them all as antigens allowing some strains to survive and so mitotic recombination could be a mechanism by which diversity arises in order for the parasite to evade the snail immune system (Caillaud et al. 2006). Sire et al. (1999) suggest that genetic diversity may be seen if there is higher productivity of snail hosts, due to an increased number of snails dying in response to a heavy parasite burden. Therefore, the different genotypes of the snail host that the parasite would be in contact with could affect the genetic diversity of the parasite. It is also suggested that if there is increased movement of the intermediate host, the Biomphalaria snail, it would encounter various different parasite genotypes from   other snail hosts (Sire et al. 1999). Therefore genetic diversity within schist osomes would be present. In this study mitotic recombination has caused greater genetic diversity in the female   parasite. This is vital for reproduction as it is the female that produces eggs (Clough 1981) therefore if more female genotypes able to evade the snail immune system and survive it means an increase in reproduction. The Red Queen Hypothesis is a co-evolutionary hypothesis suggesting that as the Biomphalaria snail host genes evolve the genes of the parasite that allow infectivity of the host will evolve alongside them (Van Valen 1973). Therefore, it could be this evolution of the parasite genes (Figure 6) affecting the ability of the schistosome population to infect the snail host which causes the genetic diversity (Carius et al. 2001). Figure 6. Red Queen Hypothesis showing the co-evolution of the snail host and the parasite. 4.3 The use of RAPD and rDNA markers in emphasising genetic diversity within schistosomes In this study the use of RAPD markers have been successful in highlighting the different genotypes present amongst S.mansoni and S.rodhaini hybrids. RAPD markers are therefore successful at allowing for genetic diversity to be quantified (Langand et al. 1999). RAPD markers have enabled the quantification of the different genotypes of the schistosome hybrids in this study and this is supported by Barral et al. (1996) who concluded that RAPD markers were efficient at providing a way of displaying genetic diversity within a schistosome population. Using reproducible RAPD markers is advantageous as it validates the results of this experiment as if the experiment was repeated the same results would be produced. If after repeating, the same results were found as reproducible RAPD markers were used it would further conclude that genetic diversity is definitely present in schistosome population. For the schistosome hybrids two ITS-2 bands were present on the gel and the reason for this is unclear. It could be due to lack of specific species barriers this second band has appeared. It could also be due to priming on another site, such as a viral or transposable element which has similarities to ITS-2 has inserted itself into the genome and how shown up on the gel as a second ITS band. Although it was not possible to sequence the ITS – 2 region, the sequencing generated by Steinauer et al. (2008) showed that there was genetic diversity within the F1 offspring. This genetic variation could also be caused by mitotic recombination happening within the asexual stage of the life cycle. References Archetti, M. (2003) A selfish origin for recombination. Journal of Theoretical Biology,  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   223(3), 335-346. Barral, V., Morand, S., Pointier, J.P., and Theron, A. (1996) Distribution of schistosome genetic diversity within naturally infected Rattus rattus detected by RAPD markers. Parasitology, 113(6), 511 – 517. Bayne, C.J., and Grevelding, C.G. (2003) Cloning of Schistosoma mansoni sporocysts in vitro and detection of genetic heterogeneity among individuals   within  Ã‚  Ã‚  Ã‚   clones. The Journal of Parasitology, 89(5), 1056-1060. Beltran, S., Galinier, R., Allienne, J., and Boissier, J. (2008) Cheap, rapid and  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  efficient DNA extraction method to perform multilocus microsatellite genotyping on all Schistosoma mansoni stages. Memà ³rias do Instituto   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Oswaldo Cruz, 103(5), 501-503. Berquist, R., Al-Sherbiny, M., Barakat, R., and Olds, R. (2002) Blueprint for schistosomiasis vaccine development. Acta tropica, 82(2), 183 – 192. Burton, R.S. (1990) Hybrid breakdown in developmental time in the copepod Tigriopus californicus. Evolution, 44(7), 1814 – 1822. Caillaud, D., Prugnolle, F., Durand, P., Theron, A. and de Meeus, T. (2006) Host sex and parasite genetic diversity. Microbes and Infection, 8(9-10), 2477 – 2483. Carius, H.J., Little, T.J. and Ebert, D. (2001) Genetic variation in host-parasite association: potential for coevolution and frequency-dependent selection. Evolution 55(6), 1136-1145. Chambers, G.K., and MacAvoy, E.S. (2000) Microsatellites: Consensus and controversy. Comparitive Biochemistry and Physiology, 126(4), 455 – 476. Clerinx, J., and Van Gompel, A. (2011) Schistosomiasis in travellers and migrants. Travel Medicine and Infections Disease, 9(1), 6-24. Clough, E.R. (1981) Morphology of Reproductive Organs and Oogenesis in Bisexual and Unisexual Transplants of Mature Schistosoma mansoni Females. The Journal of Parasitology, 67(4), 535-539. Curtis, J., and Minchella, D.J. (2000) Schistosome Population Genetic Structure: When Clumping Worms is not just splitting hairs. Parasitology Today, 16(2), 68-71. Dabo, A., Durand, P., Morand, S., Diakite, M., Langand, J., Imbert-Establet, D., Doumbo, O., and Jourdane, J. (1997) Distribution and genetic diversity of Schistosoma haematobium within its bulinid intermediate hosts in Mali. Acta Tropica, 66 (1), 15-26. Dobzhansky, T. (1950) Genetics of natural populations. XIX. Origin of heterosis through natural selection in populations of Drosophila pseudoobscura. Genetics 35(3), 288 – 302. Durand, P., Sire, C., and Theron, A. (2000) Isolation of microsatellite markers in the digenetic trematode Schistosoma mansoni from guadeloupe island. Molecular Ecology, 9(7), 997-998. Dybdahl, M.F. And Storfer, A. (2003) Parasite local adaptation: Red Queen versus Suicide King. Trends in ecology and evolution 18(10), 523-530. Gower, C.M., Shrivastava, J., Lamberton, P.H.L., Rollinson, D., Webster, B.L., Emery, A., Kabatereine, N.B., and Webster, J.P. (2007) Development and application of an ethically and epidemiologically advantageous assay for the multi-locus microsatellite analysis of Schistosoma mansoni. Parasitology, 134(4), 523-536. Grevelding, C. G. (1999) Genomic instability in Schistosoma mansoni. Molecular and Biochemical Parasitology, 101(1-2), 207-216. Gryseels, B., Polman, K., Clerinx, J., and Kestens, L. (2000) Human schistosomiasis. The Lancet, 368(9541), 1106-1118. Ismail, M., Botros, S., Metwally, A., William, S., Farghally, A., Tao, L. F., Day, T.A., and Bennett, J.L. (1999) Resistance to praziquantel: Direct evidence from Schistosoma mansoni isolated from egyptian villagers. The American Journal of Tropical Medicine and Hygiene, 60(6), 932-935. Langand, J., Theron, A., Pointier, J.P., Delay, B., and Jourdane, J. (1999) Population structure of Biomphalaria Glabrata, intermediate snail host of Schistosoma mansoni in Guadeloupe Island using RAPD markers. Journal of Molluscan Studies, 65(4), 425-433. Lynch, M., and Milligan B.G. (2004) Analysis of population genetic structure with RAPD markers. Molecular Ecology, 3(2), 91-99. Mann, V.H., Morales, M.E., Rinaldi, G., and Brindley, P.J. (2009) Culture for genetic manipulation of developmental stages of Schistosoma mansoni. Parasitology, 137(3), 451-462. Minchella, D.J. (1984) Host life-history variation in response to parasitism. Parasitology, 90(1), 205-216. Morgan, J.A.T., DeJong, R.J., Lwambo, N.J.S., Mungai, B.N., Mkoji, G.M. and Loker, E.S. (2003) First report of a natural hybrid between Schistosoma mansoni and S. rodhaini. The Journal of Parasitology, 89(2), 416-418. Rodrigues, N., Coura Filho, P., De Souza, C., Jannoti Passos, L., Dias-Neto, E., and Romanha, A. (2002) Populational structure of Schistosoma mansoni assessed by DNA microsatellites. International Journal for Parasitology, 32(7), 843-851. Simoes, M., Bahia, D., Zerlotini, A., Torres, K., Artiguenave, F., Neshich, G., Kuser, P., and Oliveira, G. (2007) Single nucleotide polymorphisms identification in expressed genes of Schistosoma mansoni. Molecular and Biochemical Parasitology, 154(2), 134-140. Sire, C., Durand, P., Pointier, J. P., and Thà ©ron, A. (1999) Genetic diversity and recruitment pattern of schistosoma mansoni in a Biomphalaria glabrata snail population: A field study using random-amplified polymorphic DNA markers. The Journal of Parasitology, 85(3), 436-441.

Study of The UK Food Manufacturing 2036 Essay Example | Topics and Well Written Essays - 6000 words

Study of The UK Food Manufacturing 2036 - Essay Example The paper has deployed a number of strategic management techniques to determine market condition, consumer demand and position of the companies thereof. SWOT, PEST and Porter’s five force analyses were considered appropriate. Besides business environment, financial and non-financial performance of each company has been assessed along with their cumulative performance for a period of five years. The paper has elaborately discussed every aspect of business with respect to the subject companies using ratio analysis. The outcomes have also been critically assessed and recommendations have been provided keeping in view the future scope of growth and development for the firms. The food sector in the United Kingdom (UK) can be chiefly segmented in four areas, namely, food manufacturing, food retailing, food wholesaling and non-residential catering. Food is an essential purchase among all others by consumers and growth of food sector is being significantly driven by increasing population. Between 1992 and 2008, the food sector of the UK grew parallel with economic boom and stabilised by 2012. The food manufacturing sector is significantly dominated by different kind of foods that can be conveniently categorised as necessity food and luxury food and be further subdivided into other categories (DEFRA, 2014a; Manley, 2010). The diversified nature of the UK food industry and its contribution in the UK economy makes it an interesting choice of research. The food manufacturing sector is an essential part of the food industry as it acts as a link between agro-food industry of raw material and food retailing and wholesaling. Food manufacturing is also essential for the food industry because it generate employment, provides export opportunities, minimises scope of import and results in great value addition to local produces and local crop producers (ILO, 2014). The research paper